Early childhood education Essay Example for Free

Early childhood education Essay Early childhood education has for a very long time been neglected by educational planners in Australia. Early childhood education is one of the most important stages in pursuit of education given the fact that the foundation children receive in their pre-school years and in early school years goes along way in shaping their prospect careers. Early childhood education in Australia is faced with several challenges key of which include lack of a systematized curriculum covering both private and public sectors. The other challenge is lack of enough trained teachers in early childhood education which has seen the standards of early childhood education deteriorate in the recent past. Although the Ministry of Education in Australia has on several occasions initiated commissions to offer long lasting solutions to the challenges highlighted above, none of this has to date yielded into success. Failure for recommendations contained in various commissions set up by the Howard government can be attributed to lack of clear policy governing early childhood education provision in Australia. Early childhood education provision in Australia has traditionally been teacher-centered as opposed to being child-centered. It has lacked impetus in that instead of focusing on the needs of the children the kind of education provided in early stages of schooling has lacked in objectivity. There is therefore a need for a lot more emphasis on children interest from an early age so as to overcome some of the challenges witnessed in latter stages of education such as upper primary and secondary levels. If children are given enough orientation at the pre-school and early school levels such children are likely to grow up with a clear focus on areas of interest something which can help resolve the low literacy and accounting skills evident amongst high school and primary schools students. Teacher training will play a very significant role in accomplishing the goals of early childhood education. Teachers play a critical role in curriculum interpretation and unless the teachers are able to interpret curriculum effectively efforts to streamline early childhood education in Australia are likely to fail. To counter such challenges there is a need for the government to offer incentives to early childhood education teachers for instance offering free training programs or alternatively offering government sponsored training programs (MacNaughton, Williams, 1998). There lacks proper curriculum to guide early childhood education and the one in place has been in use for many decades something which clearly indicates that it could have outlived its use (Margetts, 2003). Until stakeholders in early childhood education come up with solutions as well as recommendations geared towards streamlining early childhood education to meet modern educational needs then all efforts geared towards achievement of effective early childhood education provision in Australia are likely to be unsuccessful. In conclusion, early childhood education in Australia is in deplorable state. There is a need for the government to include in its educational agenda, policies which will see more funding directed to early childhood education. The government must take initiative and implement the necessary amendments to the education act which has not served early childhood education properly. There is a need for integration of early childhood education to primary education and secondary education for purposes of achieving transition so that early childhood education is not viewed as a stand alone sector in education. References MacNaughton, G. Williams, G. (1998. 69-79) Techniques for Teaching Young Children: Choices in theory and practice, Addison Wesley Longman Australia Pty Ltd, Frenchs Forest, NSW. Margetts, K. (2003. pp. 45-65) Child care arrangements, personal, family and school influences on childrens adjustment to the first year of schooling, Proceedings of the Australian Early Childhood Association Biennial Conference, Hobart 10–13 July 2003, Australian Early Childhood Association.

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Gold Rush Paper :: essays research papers

One moment the California creek beds glimmered with gold; the next, the same creeks ran red with the blood of men and women defending their claims or ceding their bags of gold dust to bandits. The "West" was a ruthless territory during the nineteenth century. With more than enough gold dust to go around early in the Gold Rush, crime was rare, but as the stakes rose and the easily panned gold dwindled, robbery and murder became a part of life on the frontier. The "West" consisted of outlaws, gunfighters, lawmen, whores, and vigilantes. There are many stories on how the "West" begun and what persuaded people to come and explore the new frontier, but here, today, we are going to investigate those stories and seek to find what is fact or what is fiction. These stories will send you galloping through the tumultuous California territory of the mid-nineteenth century, where disputes were settled with six shooters and the lines of justice were in a continuous chaos. Where's the West How and where did the West begin? This is the question that is asked most often and there is never a straight -forward answer. Everyone has their own opinion on the subject: "Oh, it started sometime in the nineteenth century," or "The west is really just considered to be Oklahoma, Texas, and Kansas." Whatever happened to California actually being considered the "West?" With all honesty, even into the twentieth century, California is not thought of as being the "West," or the "West" in the manner in which Oklahoma, Kansas and Texas are thought of. Cowboys, horses, and cattle are only considered to be in the central states, but what about California? To give a straight- forward answer on where and how the "Real West" or even the "Wild West" began; it began by a millhouse worker named James Marshall. On the morning of January 24, 1848, Marshall was working on his mill and looked down in the water and saw a sparkling dust floating along the creek bed (Erdoes 116). Assuming it was gold, he told his fellow workers what he had found and they began searching for the mysterious metallic dust as well. Four days later Marshall rode down to Sutter's Fort, in what is now Sacramento, and showed John Sutter what he had found. They weighed and tested the metal and became convinced that it was indeed gold. John Sutter wanted to keep the discovery secret, but that was going to be impossible. The rumor flew and Sutter's mill workers, which were Mormon, caught wind of it and began searching for their own fortune. Shortly after they fled, they

The Partner by John Grisham Essay -- The Partner by John Grisham

The Partner by John Grisham The Partner is one of John Grisham's best books by far! There was a little more description in The Partner, then in The Firm, but this one had a very slow intro. The book opened with an anonymous man living in Brazil under an unknown name. Patrick Lanigan, now known as Danilo Silva, was living a normal life, not making a big deal about the ninety million dollars he had stolen from his ex-law firm two years ago. Danilo is wanted by his ex-law firm buddies, his client from whom he stole the money, and from the FBI. The people that want him the most were the men hired by the client that lost the ninety million, and they were the ones he was afraid of. He knew if the FBI found him he’d be busted, but also safe, if the other thugs found him, he was dead, all they cared about was the money. One day while he was jogging Danilo is kidnapped and taken to a place where he is tortured with electricity and other devious objects. The FBI received a tip that Patrick Lanigan had been captured, and when the FBI found this team of hitmen, and took Patrick, he had already received burns on his skin and charred his flesh. When Danilo returns to his home town, he once again is Patrick Lanigan, and is forced to face up to all the things he has done in his past. The first thing he does is he gets himself a good lawyer, one he knew from his first life, an old buddy from college. A judge friend, the one who spoke at his funeral, also came to visit Patrick in the ho...

Free College Admissions Essays: A Time of Growth :: College Admissions Essays

A Time of Growth    After months of waiting, I found out that I was one of the few individuals selected for a public-health internship at the World Health Organization (WHO) in Geneva, Switzerland.    I arrived in Geneva at the end of May, and began my internship at that time. On my way to work I passed by the United Nations complex, the International Red Cross and Crescent Museum, and many other international edifices. As I strolled into the World Health Organization for the first time, I was in disbelief, the WHO is the epitome of the health arena.    Public Health itself is, of course, extremely interesting to me, but more specifically one personally intriguing area is Sexually Transmitted Infections (STIs). I worked all summer in the department of STI Surveillance and Epidemiology. My specific project was to redesign and create a new global database for the surveillance of STIs. I completed my project and gave a presentation. I also created a CD-Rom to instruct new users on the details of the database, and a Microsoft Power Point version print out is included in this summary. In addition to the tremendous amount of knowledge I attained specifically while working on my project, I also gained vast experience in the complete functioning of a mass public health structure and international health issues. My co-workers and I easily established a professional relationship and soon became friends. I was invited into their lives and homes as they opted to share their food and culture with me.    Throughout my time abroad I also made the most of the opportunity to explore Europe. My WHO supervisors were very receptive and encouraging of my desire to travel. I had the opportunity to travel to various places in Italy, Spain, France, Monaco, and Switzerland.

Final Study Guide for Livanis Intl 1101

INTL 1101 Final Exam Study Guide Americanization – Consumerism, individualism – American products and values – Cultural imperialism? Trying to homogenize world? McDonaldization – Fast-food principles dominant in American and other societies – Uniform standards – Lack of human creativity – Dehumanization of social relations Infantilization – Benjamin Barber â€Å"consumed† – Against â€Å"ethos of infantilization† that sustains global capitalism – Turning of adults into children through dumbed down advertising and consumer goods – Targeting children as consumers Homogeneous global products for young and wealthy, and for children => soulless and unethical global consumerism in pursuit of profit Cultural homogenization – â€Å"More alike† theory of effects of globalization – Western culture industry – Homogenization of popular culture – Can be within western soci eties (McDonaldization) Market for loyalties – Regulation of communications to organize cartels of imagery – Domestic broadcast regulation maintains distribution of power – National identity reframed to political views and cultural attitudes that maintain existing power structure Facilitates predominance of one ideology Cultural imperialism – World patterns of cultural flow, mirror the system of domination in world economic and political order – Not confined to the west: see Mexico, Brazil (Latin America), India (East Asia), Hong Kong, Taiwan (China) Sustainable development – Long-term economic growth depends on careful stewardship of the natural environment – Environmentalists – Liberalization= unequal economic growth, resources for debt, competition (race to the bottom), increased pollution, unsustainable consumption of resources, political unrest – Free Trade Trade promotes growth and alleviates poverty= environmental benefits – Elimination of trade barriers= increased value of resources – Environmental progress is easier to achieve under conditions of prosperity Deterritiorlization of religion – Primarily caused by migration – The case of Islam: – Muslim Ummah – Re-islamisation as deculturalisation of Islam (not linked to a particular pristine culture, global Islam) – Quest for definition: Islam to fit every culture – By bridging the gap between secularism and religiosity, Fundamentalism overstretches religion to the point that it cannot become embedded in real cultureFree trade and the environment Technological Change and Disease – Transportation – Short term travel: 940 million tourists – Meningitis: 70,000 pilgrims to Mecca every year, secondary pandemics upon return – Expensive diseases in developing countries and eradicated diseases in developed countries – Medical technologies – Greater colla boration, more information – BUT, new technologies can be badly used – Ebola in DRC, AIDS epidemics in China from unsterilized needles Demographic Change and Disease – Population mobility Conditions that lead people to move are the same that favor the emergence of infections (poverty, overcrowding, unsanitary conditions, state failure) – Refugees: sanitation, food, healthcare – 50,000 dead in a month (Rwanda, 1994) – Haiti: cholera from Nepal? (4,800 mortalities) – Long-term migration – Disease to non-immune populations, and transfer of new disease back home – Eradicated diseases re-introduced – Migrant workers in Africa (AIDS epidemics) – Urbanization – Megacities=megaspread Global economy and disease – Global trade IMF/structural adjustments and liberalization reduces the role of governments (mostly in providing healthcare) – Trade in food – Change in dietary habits, convergenc e of tastes – Demand for year-round availability of fresh fruit and vegetables – Products from less expensive labor markets, worldwide ingredients and transport – Food may be contaminated – Unhygienic irrigation, packaging practices, storage, non-indigenous crops more susceptible to indigenous pathogens – E-coli in Germany: 2,800 affected, 26 dead (91 in EU) – Mad Cow Disease Environmental change and disease Climate change-global warming – Higher ambient air temperature, precipitation/humidity (mosquitoes) – Water supply-dams etc – Profound ecological changes that affects disease vectors-most dams associated with increase in malaria – Deforestation – Increases contact between humans and pathogens – Decreases natural predators of disease vectors – Increases in malaria (runoff water stagnant in pools) – Loss of biodiversity Jihad and McWorld – Dialectical nature: one cannot exist w ithout the other – Babel: retribalization – Global jihad against globalization – Disneyland Globalizations – Jihad and McWorld make war on the sovereign nation state – Indifference to civil liberty – McWorld, focus on consumption and â€Å"invisible hand† for common good (rather than democratic institutions), repeal government regulations – Jihad, bloody politics of identity, exclusion and hatred, paternalism and tribalism – Neither global markets nor blood communities service public goods or pursue equality and justice – Future? – In the short run – Jihad likely to dominate? – In the long run – McWorld dominates? – Convergence of political ideologies? Triumph of liberalism? Convergence of political cultures? Triumph of Western individualism? – Or greater divergence and even conflict? Ethnicity – High ethnic solidarity: willing to redistribute resources within the g roup – No â€Å"master list†; what differentiates groups in one place may not be important in another – Example: in Serbia, common language and culture, but religion divides (Hutu and Tutsi) – Ethnicity as a â€Å"social construction†Ã¢â‚¬â€not inherently political Ethnic identity – Any specific attributes and societal institutions that make one group of people culturally different from others Language, religion, geography, customs, history, and others – Ascription—an identity assigned at birth – Largely fixed during our lives Clash of civilizations – Samuel Huntington: â€Å"The Clash of Civilizations† – â€Å"The next world war, if there is one, will be a war between civilizations† – De-Westernization and indigenization of societies – Hinduization of India and Islamic fundamentalism (Iran, Algeria, Egypt, Turkey) – The Confucian-Islamic connection – Kin-country s yndrome (Bosnia, Iraq) – Civilizations do not control states; states control civilizations Interpreted the same events as Fukuyama, but made very different conclusions †¦ — Outlined 7 main cultures (and a possible 8th); equates â€Å"culture† with â€Å"religion†: â€Å"people who share ethnicity and language but differ in religion may slaughter each other, as happened in Lebanon, the former Yugoslavia, and the Subcontinent. † 1. Western 2. Confucian 3. Japanese 4. Islamic 5. Hindu 6. Slavic-Orthodox 7. Latin American 8. Possibly African – Why will they clash? – Differences are both real and basic (â€Å"fundamental†) – World smaller due to globalization – Nation-state as source of identity grows weaker Fundamentalist religion grows stronger – Backlash against West enhances civilization consciousness – Cultural differences less easily compromised than political and economic ones (can you be both Catholic and Muslim? ) – Economic regionalism is growing – Result: unable to mobilize support for governments based on ideology, turn to religion and civilization identity Environmentalism and the developing south Collectivity Irreducibility Characteristics of environmental issues – Complexity – Interpenetration, pollution down the road. – Temporal and spatial uncertainty – What will happen in the future, how much is it going to affect us. Irreducibility – Holistic in nature, we cannot approach only one part, we have to consider them as a whole. – Spontaneity – Things tend to happen fast especially in environmental disasters. – Collectivity – Collective action problems, common pool resources, shirking/free-riding Chinese triad Food security – All people at all times have physical and economic access to sufficient, self-nutritious food to meet their dietary needs and food preferences for an active an d healthy life. (UN’s Food and Agriculture Organization) – Peak oil, peak water, peak phosphorus, peak grain, and peak fish Green revolution Problems in beginning of 20th c: not producing enough food to feed expanding population – Green Revolution: 1950-1984 – Development of high-yielding varieties of cereal grains – Expansion of irrigation infrastructure – Hybridized seeds & – Synthetic fertilizers & – Pesticides to farmers in developing countries – Transformed agriculture around the globe – World agricultural production more than doubled (world grain production increased by 250%) – Increased fossil fuel-based energy use: – Natural gas (for production of synthetic fertilizers) – Oil (for development of pesticides) – Hydrocarbon fuelled irrigation Unsustainable? (Malthusian argument) – May not necessarily increase food security (other political causes) – Promotion of monoc ultures, hunger vs malnutrition – Benefited wealthier farmers at the expense of poorer ones => urban migration – Extensive use and abuse of pesticides and fertilizers associated with negative health effects (cancer) – Land degradation, soil nutrients depletion Earth’s carrying capacity – No one knows!!! The Future of Food – Film watched in class, google if can’t remember GMOs Montreal Protocol – The 1987 Montreal Protocol on Substances That Deplete the Ozone Layer mandated that industrialized countries reduce their production and use of the five most widely used CFCs by 50 percent. – Delegates agree to give developing countries a ten-year grace period, allowing them to increase their use of CFCs before taking on commitments – Without the Montreal Protocol, global CFC consumption would have reached about 3 million tons in 2010 and 8 million tons in 2060, resulting in a 50 percent depletion of the ozone layer by 203 5 – Montreal Protocol currently calls for a complete phaseout of HCFCs by 2030 (does not place any restriction on HFCs)Arms Trade Treaty – 2003, Control Arms Campaign was launched (Controlarms. org) – 2006, Control Arms handed over a global petition called â€Å"Million Faces† to the UN Secretary General Kofi Annan 2006 – 2006, 153 states vote resolution 61/89 requesting the UN Secretary-General to seek the views of Member States (U. S. votes against, national controls better) – 2009, UN General Assembly launches a time frame for the negotiation of the Arms Trade Treaty. U. S. osition overturned – 2-27 July, 2012 (New York) – Currently under final negotiations – Require states to have national mechanisms for express authorization of international transfers of arms – Prohibit transfers of arms that could violate human rights and international law – Treaty Failure: – United States said it â€Å"needed more time† to review the short, 11-page treaty text (Obama administration torpedoed the treaty exactly one week after the massacre in Aurora, Colorado) Not to export weapons to countries that are under an arms embargo, or to export weapons that would facilitate â€Å"the commission of genocide, crimes against humanity, war crimes† or other violations of international humanitarian law. – Exports of arms are banned if they will facilitate â€Å"gender-based violence or violence against children† or be used for â€Å"transnational organized crime. † – The sides, now: – Nearly 120 countries, led by Mexico, issued a joint statement on Monday saying â€Å"the overwhelming majority of (U. N. ) Member States agree with us on the necessity and the urgency of adopting a strong Arms Trade Treaty.Our voice must be heard. † – The five permanent Security Council members – the United States, Britain, France, China and Russia â⠂¬â€œ issued their own joint statement of support for a treaty that â€Å"sets the highest possible common standards by which states will regulate the international transfer of conventional arms. † – Important Points: – Ammunition. – Exports of ammunition are covered in the draft treaty but not imports. – Self-defense. – Some major arms-importing states (Middle East), expressed concern that their ability to import weapons could suffer if the treaty comes into force. Exemptions. – There are a number of scenarios under which arms deals would be exempt in the current draft, such as defense cooperation agreements (India) – and gifts, loans and leases of weapons. – Reporting. – Current draft says countries will send reports to the U. N. on their international arms trade but does not call for them to be made public. China, Iran and others do not want that information disseminated openly. – The NRA says the treaty would undermine gun ownership rights under the Second Amendment to the U. S. Constitution. MalnourishmentObstacles to cooperation on environmental issues (regime, actor, general) National Identity – National identity is inherently political – Defined as a sense of belonging to a nation and a belief in its political aspirations – Often, but not always, develops from existing ethnic identity – Sense enhancers: – Common history, territory, culture, economy, rights – Why form? – Ethnic group may feel oppressed – Ethnic group may form a minority population – These conditions may call for self-government Boat people Ozone success – The 1987 Montreal Protocol on Substances That Deplete the Ozone Layer mandated that industrialized countries reduce their production and use of the five most widely used CFCs by 50 percent. – Delegates agree to give developing countries a ten-year grace period, allowing them to increa se their use of CFCs before taking on commitments – New scientific evidence late 1987 – scientists announced that CFCs probably were responsible for the ozone hole – 1988, satellite data revealed that stratospheric ozone above the heavily populated Northern Hemisphere had begun to thin – Changes in the pattern of economic interests Du Pont announced that they would soon be able to produce CFC substitutes – Followed the next year by other large chemical manufacturers, including several in Europe – Major producers no longer opposed a CFC phase-out – Lobbied for extended transition periods and against controls on potential substitutes – Particularly hydro chlorofluorocarbons (HCFCs)—a class of CFC substitutes that deplete ozone but at a significantly reduced rate. – The ozone regime stands as the strongest and most effective global environmental regime. – The worldwide consumption of CFCs, which was about 1. m illion tons in 1986, was approximately 100,000 tons in 2010. – Without the Montreal Protocol, global CFC consumption would have reached about 3 million tons in 2010 and 8 million tons in 2060, resulting in a 50 percent depletion of the ozone layer by 2035 – HCFCs, and HFCs, are now thought to contribute to anthropogenic global warming – Up to 10,000 times more potent greenhouse gases than carbon dioxide – Montreal Protocol currently calls for a complete phaseout of HCFCs by 2030 (does not place any restriction on HFCs) Restaveks (or stay-withs) 300,000 children in domestic bondage in Haiti – Forced – Unpaid Overcropping – Deplete soil by continuously growing crops on it Overpopulation – Carrying capacity – Estimates vary widely – Inadequate fresh water – Depletion of natural resources, especially fossil fuels – Increased levels of air pollution, water pollution, soil contamination – Deforestat ion and loss of ecosystems – Changes in atmospheric composition and consequent global warming – Irreversible loss of arable land and increases in desertification – Mass species extinctions from reduced habitat in tropical forests due to lash-and-burn techniques (140,000 species lost per year – High infant and child mortality. – Intensive industrial farming: evolution and spread of antibiotic resistant bacteria diseases – Increased chance of the emergence of new epidemics and pandemics. – Low life expectancy in countries with fastest growing populations. – Unhygienic living conditions – Increased levels of warfare – Elevated crime rate – Less Personal Freedom / More Restrictive Laws. Demographic Transition – If standard of living and life expectancy increase, family sizes and birth rates decline Later ages of marriage, careers outside child rearing and domestic work, decreased need of children in indu strialized settings – Led to increased worry about aging populations and decreased worry about future impact of population growth – BUT, after a certain level of development the fertility increases again! – Fertility-opportunity hypothesis Food vs. fuel Precision farming – Soil erosion dropped, no-till seed planting – Drip irrigation, level fields (eliminate runoff) – Global positioning: efficient harvest, less chemicals Citizenship Citizenship: individual’s or group’s relationship to the state – Swear allegiance to the state – State provides benefits – People have obligations in return – Ethnicity is fixed but citizenship is not – Can be changed by individual or state – Potentially more inclusive concept than ethnicity or national identity – Three (ethnicity, citizenship, national identity) are often connected—an ethnic group forms the nation, and they represent the citiz ens of a country Nationalism – Nationalism as a pride in one’s people and belief in sovereign destiny Seek to create or preserve one’s own nation (political group) through an independent state – Sovereignty is thus key – Example: Great Britain – Governments determine nationality – 1707 – The United Kingdom came into existence – Yet there was no British nation since the people of the English isles were thinking of themselves as English, Welsh, Scots, or Irish. – Propagation of the dominant English culture and language through the years created a sense of English identity. – During the 19th century non-English cultures were suffocated. Global fundamentalism Return to traditional religious values as a reaction to modernity and global culture – Restoration of sacred tradition as basis for society – Cultural authenticity vs universalizing global culture – Global phenomenon – Modern ph enomenon – Fundamentalism vs globalization or fundamentalism as part of globalization? AIDS – Peaked in 2005 with 3. 4 million deaths – ~35 million infected – 14,500 new infections daily – Approximately 8000 deaths daily (3million/year) – > 90% new infections in Global South – Global responses – Millennium Development Goal 6 – Combat HIV/AIDS, malaria and other diseases Government-subsidized antiretroviral medications (Brazil, Argentina etc) – Samaritan’s Purse – The importance of Global Health Partnerships – Improving access to medicines – Financing health activities – BUT, primarily â€Å"vertical† (focus on specific diseases, and development/distribution of medicines) – Retroactive: does not focus on improving health care systems and primary care – Multiplicity of donors and actors: not aligned with government priorities International Organized Crime †“ Effort to exploit mechanisms of globalization – Transportation and communications technology Aided by deregulation – Possible through corruption of authorities, unethical practices of individuals and corporations – Extremely large profits (and high risk) – Global cities are main areas of activity (New York, London, Tokyo, etc. ) – Using financial services to disguise criminal activities – Defy the state, offer parallel black market structure Deforestation – Increases contact between humans and pathogens – Decreases natural predators of diseases vectors – Increases in malaria (runoff water stagnant in pools) (mosquitos) – Loss of biodiversity Arms Trafficking Lack of international treaty regulating legal arms trade – Illegal arms trade – Arms fuel conflict and crime – $60 billion a year industry – Lack of transparent data – UN: attempt to â€Å"crush illicit trade of small ar ms† – Cold War – Preoccupation with nuclear arms control – Small arms were not as widely disseminated – End of Cold War – Small arms â€Å"surplus† – Warsaw Pact/NATO upgrades – Difficulty in negotiations? – U. S. position – Nuclear weapons easier to negotiate Human trafficking – Labor trafficking – Sex trafficking – Victims are primarily women and children – Organ trafficking Trafficking of babies and pregnant women – Baby farm in Nigeria: sold for illegal adoption or for use in ritual witchcraft Child Soldiers Slavery – â€Å"A slave is a human being forced to work through fraud or threat of violence for no pay beyond subsistence. † (Benjamin Skinner) – â€Å"Do you want a job? † – Modern slavery: – More slaves now than ever before in history, 27 million – Each year 50,000 children and teenagers enter the US against their w ill for purposes of sexual slavery (CIA est. ) – Over 2 million trafficked slaves forced into prostitution and labor around the world 10 million slaves in South Asia (many through more than one generations) until they pay off their â€Å"debt† – 300,000 children in domestic bondage in Haiti Small arms – Over half a million people are killed each year with small arms across the world – In the United States 34,000 people are killed per year by small arms – The cost of small arms on public health, in Latin America at 14% of GDP, 10% of GDP in Brazil, and 25% of GDP in Colombia. – Registered homicide rates for Colombia, the United States, Brazil, and Venezuela among males aged 15–24 have doubled in the last ten yearsMonocultures – The agricultural practice of producing or growing a single crop or plant species over a wide area and for a large number of consecutive years. – It is widely used in modern industrial agricu lture and its implementation has allowed for large harvests from minimal labor. – Monocultures can lead to the quicker spread of diseases, where a uniform crop is susceptible to a pathogen Sustainable agriculture – http://en. wikipedia. org/wiki/Sustainable_agriculture Environmental change and conflict – http://www. accord. org. za/downloads/ct/ct_2011_2. pdf Environmental security Environmental change is an important source of social conflict – Many societies face more dangers from environmental change than from traditional military threats – Security policies must be redefined to take account of these new realities – Only by framing the environmental problem in security terms can the necessary level of governmental attention and social mobilization be ensured – Security institutions could contribute directly to environmental protection, given their financial resources, monitoring and intelligence-gathering capabilities, and scientif ic and technological expertise – Is there enough evidence to support the claim that ecological change is, or will be, a major new source of conflict? – Proponents: – Environmental scarcities are already contributing to violent conflicts in many parts of the developing world. These conflicts are probably the early signs of an upsurge of violence in the coming decades that will be induced or aggravated by scarcity – Opponents – Environmental problems are a symptom of conflict-prone social systems rather than a root cause of conflict – Are the advantages of linking environmental problems to security concerns worth the risk of militarizing a society's responses to environmental problems? Risks undercutting the globalist and common fate understanding that may be necessary to solve the problem – If pollution a national security problem, then pollution by other countries worse than home born – It is analytically misleading to think of environmental degradation as a national security threat. – Environmental degradation and violence are very different types of threats – Organizations that provide protection from violence differ greatly from those in environmental protection – Military organizations are secretive, extremely hierarchical and centralized, and normally deploy vastly expensive, highly specialized and advanced technologies – Is environmental security an idea with more appeal in the North than the South? An excuse to continue the North's longstanding practice of military and economic intervention – Focus on the South is a way for the North to deny its own responsibility – Calls to link the environment with security raise deep suspicions about ulterior motives Concern, contractual environment, capacity – da fuk? Fertility opportunity hypothesis – Fertility follows perceived economic opportunity – Against food aid, and development Transnational organized crime groups – Operate above and below the state – Create demand – Reach to the marginalized, impoverished and other â€Å"losers† of globalization – Use market strategies: – Hierarchically structured – Strategic alliances – investing/laundering capital – New growth areas (ex. umping toxic waste in developing countries and then negotiating lucrative contracts for the cleanup industry) – R&D – Modern accounting systems, information technologies, insuring against risk Global health partnerships Global food crisis – Enough food in the world to feed everyone but†¦ – 925 million people experience hunger – 2/3 of these people are in Asia and the Pacific region – Highest concentrations in India, China, DRC, Bangladesh, Indonesia, Pakistan, Ethiopia – 5 million children under 5 die of hunger in developing countries – Charity may help immediate problem but is no long-term sustainable solution – Causes for food crisis 1: Natural disasters – Floods, tropical storms, and, especially, long droughts – More common and more intense (global warming) – Wars – Population displacement – Famine used as a weapon – Fields and water wells mined or contaminated – Poverty trap – Lack of seed money, land and agricultural education – Trapped in poverty by hunger – Causes for food crisis 2: – Lack of agricultural infrastructure – Lack of roads, irrigation systems, warehouses – Emphasis on urban development – Overexploitation of the environment – Poor farming practices – Deforestation – Overcropping – Overgrazing – Economic downturns FAO – Food and Agriculture Organization (FAO) Policy and technical assistance to developing countries for food security, nutrition and agriculture – Forum for negotiation of a greements and debate on policies Fukuyama (the end of history) – Francis Fukuyama, â€Å"The End of History† – â€Å"The triumph of the West†¦an unabashed victory of economic & political liberalism†¦& the total exhaustion of viable systematic alternatives to Western liberalism. † – Liberal democracy will make the world safer – Democracies do not go to war against each other – Globalization – interdependence – Great faith in International Organizations – Washington Consensus – Critics: – Environmentalists – Marxists – Anarco-capitalism – Etc.

Metaphysics is the main philosophy in Minority Report Essay

There are several branches of philosophy found in Minority Report –ethics, truth and metaphysics. Ethics is the study of morality; truth is the study of what is true; metaphysics questions reality. The most prominent philosophy in the film is metaphysics, due to it being the underlying philosophy that created the problem and causes the plot to occur in the first place. Ethics and truth are branches of philosophy evident in the film. In Minority Report, the pre-cogs are 3 children who live in half-awake conditions and have previsions of murder scenes simply for a utilitarian purpose, and also the personal gain of Burgess. It is not right to forego the freedom, innocence and happiness of 3 children just to prevent murders. Even though it is true that they are â€Å"suffering† for the greater good, however, they are still human beings and should have equal rights. It might be a â€Å"gift† to be able to predict murders and stop them from happening, and thus saving lives, and improving the security and safety of the people, however, if it is at an expense of the three pre-cog’s childhood and freedom, the ethical values of the government are definitely questioned. Truth is another branch of philosophy found in the film as the Pre-crime Department functions solely based on the previsions of the pre-cogs, which they deem to always be true. As said by Witwer, the Pre-crime Department is â€Å"arresting individuals who have broken no law†. It is impossible to prove that they were going to murder without physical evidence that it actually happened. Furthermore, the analogy brought up by Anderton to justify â€Å"the fact that you prevented it does not change the fact that it wasn’t going to happen† is simply a straw man fallacy. Due to the laws of physics, it is supposed to fall due to gravity. However, it is impossible to predict what a human being does since every individual is different. A vision is not sufficient to prove a crime as big as murder, and simply because there have been no failures does not prove that a failure will not happen. And in fact, in the movie, several murders took place due to corruption. This questions what is actually true in the movie. Even though the philosophies truth and ethics are found in the film, the story is not based on whether using the 3 pre-cogs is right, or if the visions they were providing are right and reliable, but instead on how John defies the path he is made to take, which arose from finding freewill in a deterministic world. The main philosophy branch found in the film is metaphysics, more specifically an argument between determinism and free will, which are branches of metaphysics. The concept of determinism is prominent in the film since the entire setting of the story is in a futuristic world (2054) where a government branch, Pre-crime Department, prevents crimes from happening based on psychic visions. The fact that pre-cogs are used due to their ability to foresee murders before they happen implies that there exists a â€Å"forth-dimension† where our futures (and essentially our lives) are being controlled and pre-made by an infinite being. This also means that we are simply playing out the roles already set out for us. The whole idea of determinism, which is a philosophy that humans have no control over their own actions and their actions are caused by an external power, is further emphasized by statements said by Anderton such as â€Å"The fact that you prevented it does not change the fact that it wasn’t going to happen. † This statement, as well as another said by Burgess â€Å"You do not choose the things you believe in, they choose you†, suggests that our futures are already predetermined.